Pillar 3
Pillar 3 contains a cipher with hexagonal letters of the DNA molecule base pairs (Unsolved), a star-based cipher (Not transcribed and Unsolved) and a series of numbers around the bottom which probably form part of a cipher (Unsolved).
Hex Code
The hexagonal glyphs represent the letters of DNA: G, A, T, C in a highly stylised form - compiled in pairs as in DNA.
In the middle of the top line, a hexagon replaces one of the base pairs - it is marked in the transcription as "?".
Transcription of the DNA-hexagons is:
TCGGTAGTTGCTTC?AAGCGTGCTAGC AGCCATCAACGAAG?TTCGCACGATCG
ACCCATGCCAGGGTGGTCCTCCGTATG
GGGGACACGCATTTTGGCAGACTACTG
CTTCCGTGTGCCCGGCGAGTATGCCAT
GCAATCAATGGAAACGCACGAGAGCCG |
Star code
To be transcribed and photos compiled. See the image gallery in the interim. If you have any suggestions about a lettering or numbering system for describing these glyphs, please email me at dkrypt@dkrypt.org
Base
A series of numbers run around the base of Pillar 3:
10 12 12 14 11 12 14 15 28 3016 17 11 11 8 10 10 15 19 24 9 12 11 13 9 93 8 8 14 17 |