Pillar 3

From Decrypting the NKRYPT sculpture
Revision as of 22:54, 29 July 2013 by Admin (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search
Pillar 3 in the daytime

Pillar 3 contains a cipher with hexagonal letters of the DNA molecule base pairs (Unsolved), a star-based cipher (Not transcribed and Unsolved) and a series of numbers around the bottom which probably form part of a cipher (Unsolved).

Pillar 3 is 2379mm tall and is the fourth tallest of the eight pillars.

Hex Code

Photograph of the DNA code grid

The hexagonal glyphs represent the letters of DNA: G, A, T, C in a highly stylised form - compiled in pairs as in DNA.

In the middle of the top line, a hexagon replaces one of the base pairs - it is marked in the transcription as "?".

Transcription of the DNA-hexagons is:

TAGGTAGTTGCTC?AAGCGTGCTAGC

ATCCATCAACGAG?TTCGCACGATCG


TGGGTACGGTCCACCAGGAGGCATAC

ACCCATGCCAGGTGGTCCTCCGTATG


CCCCTGTGCGTAAACCGTCTGATGAC

GGGGACACGCATTTGGCAGACTACTG


GAAGGCACACGGCCGCTCATACGGTA

CTTCCGTGTGCCGGCGAGTATGCCAT


CGTTAGTTACCTTGCGTGCTCTCGGC

GCAATCAATGGAACGCACGAGAGCCG

The DNA code was solved by Bob Dovenberg and a solution posted on 26 March 2013 to the Nkrypt Facebook page with the following explanation:

To solve this code, one needs to use three letter DNA “words” or codons. Each codon maps to an amino acid, of which there are 20. Each amino acid is assigned a letter (note that O,U, B, J, X and Z are excluded – Kudos to Stuart for writing a passage that doesn’t require those letters). Rows one, three and five are read upright using the LOWER row of letters. As in the other puzzles, row 2 and 4 are read upside down, again using the lower row of letters. Note that the hexagon was likely inserted to make the number of letters divisible by three. It is traversed labyrinth style in the normal fashion. When decrypted it reads:

Farsighted Lady,

We May Spawn

A Repainted Thylacine

My guess is this refers to the use of DNA to bring the Tasmanian Tiger back from extinction through the use of DNA cloning. A quick Google search suggests the farsighted lady may be Marilyn Renfree from Melbourne University, but I really have no idea.

Star code

An example of the star code
star code photomontage
star code reconstructed from measurements

To be transcribed and photos compiled. See the image gallery in the interim. If you have any suggestions about a lettering or numbering system for describing these glyphs, please email me at dkrypt@dkrypt.org

The cipher consists of 368 astroids arranged in 42 columns. The columns are regularly spaced around 20mm apart. The astroids are about 15mm across, and in many cases overlap each other. They are irregularly positioned down the column.

Base

A string of numbers run in a circular pattern around the base of each pillar (see notes on the base code). On this pillar, it reads:

10 12 12 14 11 12 14 15 28 30 16 17 11 11 8 10 10 15 19 24 9 12 11 13 9 93 8 8 14 17